Stem-loop sequence ath-MIR416

AccessionMI0001427 (change log)
DescriptionArabidopsis thaliana miR416 stem-loop
Literature search

1 open access papers mention ath-MIR416
(2 sentences)

Stem-loop 
      aac     cc   uu             -gcg  -g      
5' cga   ugaac  ggu  guacguauggacc    uc  uugga 
   |||   |||||  |||  |||||||||||||    ||  |||| a
3' gcu   acuug  uca  caugcaugcuugg    ag  aaccu 
      ---     --   --             acca  aa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 7008520-7008599 [+]
intergenic
Database links

Mature sequence ath-miR416

Accession MIMAT0001324
Sequence

57 -  

gguucguacguacacuguuca

 - 77

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).