Stem-loop sequence ath-MIR417

Accession

MI0001428 (change log)

Description

Arabidopsis thaliana miR417 stem-loop

Literature search

3 open access papers mention ath-MIR417
(3 sentences)

Stem-loop

           u   -aa  -gg  aa    -cg      uuu           uc  cuu   ga 
5' aaauauau caa   gu   uc  aaca   ucacua   ccuuuauguuu  cc   auu  u
   |||||||| |||   ||   ||  ||||   ||||||   |||||||||||  ||   |||   
3' uuuauaua guu   ua   ag  uugu   agugau   ggaaguacaaa  gg   uaa  g
           -   gua  aua  -c    uua      ---           uu  ---   ag 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr2: 13708748-13708864 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001428

Mature sequence ath-miR417

• Accession: MIMAT0001325
• Sequence: 78 - gaagguagugaauuuguucga - 98
• Evidence: experimental; Northern [1]

References

1. PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2. PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).