![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR418 |
|||||
Accession | MI0001429 (change log) | ||||
Description | Arabidopsis thaliana miR418 stem-loop | ||||
Literature search |
1 open access papers mention ath-MIR418 | ||||
Stem-loop |
au --a -ua aaaa aaa ga 5' uuuaa uuag auc gcgu aga ucc a ||||| |||| ||| |||| ||| ||| 3' agauu aguc uag ugua ucu agg u cc aag uag ---a -ca ac |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR418 |
|
Accession | MIMAT0001326 |
Sequence |
48 - uaaugugaugaugaacugacc - 68 |
Evidence | experimental; Northern [1] |
References |
|
1 |
PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"
Genome Biol. 5:R65(2004).
|
2 |
PMID:16669754
"MicroRNAS and their regulatory roles in plants"
Annu Rev Plant Biol. 57:19-53(2006).
|