Stem-loop sequence ath-MIR418

AccessionMI0001429 (change log)
DescriptionArabidopsis thaliana miR418 stem-loop
Literature search

1 open access papers mention ath-MIR418
(3 sentences)

Stem-loop 
        au    --a   -ua    aaaa   aaa   ga 
5' uuuaa  uuag   auc   gcgu    aga   ucc  a
   |||||  ||||   |||   ||||    |||   |||   
3' agauu  aguc   uag   ugua    ucu   agg  u
        cc    aag   uag    ---a   -ca   ac
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 6516218-6516290 [+]
intergenic
Database links

Mature sequence ath-miR418

Accession MIMAT0001326
Sequence

48 -  

uaaugugaugaugaacugacc

 - 68

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).