Stem-loop sequence ath-MIR420

AccessionMI0001431 (change log)
DescriptionArabidopsis thaliana miR420 stem-loop
Stem-loop
   uu       --aaucac      g  aaaau    uacu   cuaucaac 
5'   cuaaacu        ggaaau ca     ugga    aca        u
     |||||||        |||||| ||     ||||    |||         
3'   gauuuga        ccuuua gu     auuu    ugu        u
   uu       guaauuua      a  gcucu    cucu   uuucuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 25230568-25230667 [-]
intergenic
Database links

Mature sequence ath-miR420

Accession MIMAT0001328
Sequence

4 - 

uaaacuaaucacggaaaugca

 - 24

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).