Stem-loop sequence osa-MIR413

Accession

MI0001433 (change log)

Description

Oryza sativa miR413 stem-loop

Literature search

4 open access papers mention osa-MIR413
(5 sentences)

Stem-loop

   ac g  ag    ac    uc     auguggaaaacaguuagcacucuaucugagu 
5'   g cu  uuuc  uugu  ugcac                               c
     | ||  ||||  ||||  |||||                                
3'   c ga  gaag  aaca  acgug                               g
   ua a  cu    -a    uu     aaaauaaaaagacauuauuacgaacccuaau 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context

• Coordinates (MSU7): Chr12: 10136381-10136493 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001433

Mature sequence osa-miR413

• Accession: MIMAT0001329
• Sequence: 5 - cuaguuucacuuguucugcac - 25
• Evidence: by similarity; MI0001424

References

1. PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2. PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).