Stem-loop sequence ath-MIR426

AccessionMI0001441 (change log)
DescriptionArabidopsis thaliana miR426 stem-loop
Literature search

1 open access papers mention ath-MIR426
(2 sentences)

Stem-loop 
   -gaggggggaca      -ggaa  u       a   guaguacuagaauacuugu 
5'             auuuuu     au uguccuu cgg                   c
               ||||||     || ||||||| |||                    
3'             uaaaaa     ua acaggaa gcc                   c
   cucaaauuaaaa      aggag  u       -   aauaaaguuuagcaguaca
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR426 was predicted and validated using procedures described in [1], but the sequence itself was not reported (Takashi Soyano, pers. comm.). The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 22107346-22107456 [+]
intergenic
Database links

Mature sequence ath-miR426

Accession MIMAT0001337
Sequence

14 -  

uuuuggaaauuuguccuuacg

 - 34

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).