Stem-loop sequence osa-MIR426

AccessionMI0001442 (change log)
DescriptionOryza sativa miR426 stem-loop
Literature search

5 open access papers mention osa-MIR426
(7 sentences)

Stem-loop 
          uuug    uu gucc        ag     caaaauuuagugaggcaaugaaugaaaagacaucuagcg 
5' ucgcauu    gaag  u    uuacgaaa  gcuag                                       a
   |||||||    ||||  |    ||||||||  |||||                                       u
3' agcguaa    cuuc  a    agugcuuu  cgguu                                       a
          ----    cu --aa        -a     ucaaacuguguaaaaucccaauaguuuaaaauuaaaauc
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 174006-174153 [+]
intergenic
Database links

Mature sequence osa-miR426

Accession MIMAT0001338
Sequence

7 -  

uuuuggaaguuuguccuuacg

 - 27

Get sequence
Evidence by similarity; MI0001441

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).