miRBase entry: hsa-mir-424

Stem-loop hsa-mir-424


Accession
MI0001446
Symbol
HGNC: MIR424
Description
Homo sapiens hsa-mir-424 precursor miRNA
Gene family
MIPF0000164; mir-322

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR424 is a type of microRNA that has been studied in relation to tumours [PMC8007794]. In tumours larger than 5 cm, the expression of MIR424 was found to be significantly decreased [PMC8007794]. Additionally, the concentration of MIR424, which is the ortholog of rat miR322, was observed to decline shortly after the induction of vascular smooth muscle cell (vSMC) proliferation and then increase [PMC7123062]. These findings suggest that MIR424 may play a role in tumour development and vSMC proliferation [PMC8007794] [PMC7123062]. Further research is needed to fully understand the mechanisms and implications of MIR424 in these processes [PMC8007794] [PMC7123062].

Literature search
166 open access papers mention hsa-mir-424
(848 sentences)

Sequence

735528 reads, 5350 reads per million, 122 experiments
cgaggggauaCAGCAGCAAUUCAUGUUUUGAAguguucuaaaugguuCAAAACGUGAGGCGCUGCUAUacccccucguggggaagguagaaggugggg
(((((((.((.((((((..(((((((((((((.((((...)))).)))))))))))))..)))))).)).))))))).....................

Structure
---------------------       a  C      AA             g    c 
                     cgagggg ua AGCAGC  UUCAUGUUUUGAA uguu  
                     ||||||| || ||||||  ||||||||||||| |||| u
                     gcucccc aU UCGUCG  GAGUGCAAAACuu guaa  
gggguggaagauggaaggggu       c  A      CG             g    a 


Annotation confidence High
Do you think this miRNA is real?
Comments
This hairpin precursor expresses a 5' arm product, named miR-424, in human promyelocytic leukemia (HL-60) cells [1]. The level of expression of miR-424 was shown to be up-regulated 48 hours after TPA-induction. The sequence is orthologous to the experimentally verified rat miR-322 locus (MIR:MI0000589), which expresses its mature product from the 3' arm of the hairpin. The human miR-424 hairpin does not appear to contain the miR-322 sequence.

Genome context
chrX: 134546614-134546711 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-424
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-424 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-424-5p

Accession MIMAT0001341
Description Homo sapiens hsa-miR-424-5p mature miRNA
Sequence 11 - CAGCAGCAAUUCAUGUUUUGAA - 32
Evidence experimental
cloned [1-2], Northern [1]
Database links
Predicted targets

Mature hsa-miR-424-3p

Accession MIMAT0004749
Description Homo sapiens hsa-miR-424-3p mature miRNA
Sequence 48 - CAAAACGUGAGGCGCUGCUAU - 68
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043