miRBase entry: mmu-mir-434

Stem-loop mmu-mir-434


Accession
MI0001526
Symbol
MGI: Mir434
Description
Mus musculus mmu-mir-434 precursor miRNA
Gene family
MIPF0000439; mir-434

Literature search
19 open access papers mention mmu-mir-434
(115 sentences)

Sequence

821387 reads, 2508 reads per million, 93 experiments
ucgacucuggguuugaaccaaaGCUCGACUCAUGGUUUGAACCAuuacuuaauucguggUUUGAACCAUCACUCGACUCCUgguucgaaccauc
.........(((((((((((.((.((((...((((((((((((((..........))))))))))))))...))))))..)))))))))))...

Structure
ucgacucug           -a  C    CUC              uacu 
         gguuugaacca  aG UCGA   AUGGUUUGAACCAu    u
         |||||||||||  || ||||   ||||||||||||||     
         ccaagcuuggU  UC AGCU   UACCAAGUUUggug    a
------cua           CC  -    CAC              cuua 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr12: 109594506-109594599 [+]
Clustered miRNAs
12 other miRNAs are < 10 kb from mmu-mir-434
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-434-5p

Accession MIMAT0001421
Description Mus musculus mmu-miR-434-5p mature miRNA
Sequence 23 - GCUCGACUCAUGGUUUGAACCA - 44
Evidence experimental
PCR [1], cloned [2-3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-434-3p

Accession MIMAT0001422
Description Mus musculus mmu-miR-434-3p mature miRNA
Sequence 60 - UUUGAACCAUCACUCGACUCCU - 81
Evidence experimental
PCR [1], cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15854907
    RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus
    "Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C"
    "Curr Biol (2005) 15:743-749

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267