![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sbi-MIR169d |
|||||
Accession | MI0001558 (change log) | ||||
Description | Sorghum bicolor miR169d stem-loop | ||||
Gene family | MIPF0000012; MIR169_1 | ||||
Literature search |
![]()
4 open access papers mention sbi-MIR169d | ||||
Stem-loop |
-ga - g -gu ugc u - a u uggcauugcgaguuccgguu 5' agaagagg ggccuu caug ggcgagagcc cuu ggu agccaagg ugacu gccuaca g |||||||| |||||| |||| |||||||||| ||| ||| |||||||| ||||| ||||||| 3' ucuucuuc ccggaa guac ccguucucgg gag ccg ucgguucc acugg cgggugu c cug u g ugu --u u a - - uugagucgacuugaccggua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sbi-miR169d-5p |
|
Accession | MIMAT0001454 |
Previous IDs | sbi-MIR169d |
Sequence |
43 - uagccaaggaugacuugccu - 62 |
Evidence | not experimental |
Mature sequence sbi-miR169d-3p |
|
Accession | MIMAT0026431 |
Sequence |
111 - gggcggucaccuuggcuagc - 130 |
Evidence | not experimental |
References |
|
1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
2 |
PMID:22747909
"Computational identification and analysis of novel sugarcane microRNAs"
BMC Genomics. 13:290(2012).
|