miRBase entry: ame-mir-124

Stem-loop ame-mir-124


Accession
MI0001577
Description
Apis mellifera ame-mir-124 precursor miRNA
Gene family
MIPF0000021; mir-124

Literature search
2 open access papers mention ame-mir-124
(4 sentences)

Sequence

ugcuccuugcguucacugcgggcuuccaugugccaacuuuucaaaauucaUAAGGCACGCGGUGAAUGCCAAGagcg
.((((...(((((((((((((....))..(((((...................))))))))))))))))...)))).

Structure
u    cuu           gggcuuccau     aacuuuuc 
 gcuc   gcguucacugc          gugcc        a
 ||||   |||||||||||          |||||        a
 cgaG   CGUAAGUGGCG          CACGG        a
g    AAC           ----------     AAUacuua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
CM000057.5: 10394030-10394106 [+]

Database links

Mature ame-miR-124-3p

Accession MIMAT0001473
Description Apis mellifera ame-miR-124-3p mature miRNA
Sequence 51 - UAAGGCACGCGGUGAAUGCCAAG - 73
Evidence experimental
array [1], RTPCR [1-2], Illumina [3-4]

References

  1. PubMed ID: 17543122
    Computational and transcriptional evidence for microRNAs in the honey bee genome
    Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG
    Genome Biol (2007) 8:R97

  2. PubMed ID: 22409512
    Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome
    "Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y"
    "Genes Brain Behav (2012) 11:660-670

  3. PubMed ID: 20491979
    Correlated expression patterns of microRNA genes with age-dependent behavioural changes in honeybee
    "Behura SK, Whitfield CW"
    "Insect Mol Biol (2010) 19:431-439

  4. PubMed ID: 26853694
    MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)
    "Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL"
    "Insect Mol Biol (2016) 25:216-226