Stem-loop sequence ame-mir-263a

AccessionMI0001583 (change log)
Previous IDsame-mir-263
DescriptionApis mellifera miR-263 stem-loop
Gene family MIPF0000122; mir-263
Literature search

6 open access papers mention ame-mir-263a
(9 sentences)

Stem-loop
       u    u    aa       u   agaa        ggauuua 
5' agcu ggac cugu  auggcac gga    uucacggg       a
   |||| |||| ||||  ||||||| |||    ||||||||        
3' ucgg ccug gaca  uacugug ccu    aggugccc       g
       -    c    ca       c   --cg        gggcaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000068.5: 6467911-6468001 [-]
intergenic
Database links

Mature sequence ame-miR-263a-5p

Accession MIMAT0001479
Previous IDsame-miR-263
Sequence

13 - 

guaaauggcacuggaagaauucac

 - 36

Get sequence
Evidence experimental; array [1], RTPCR [2], Illumina [3]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).