![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ame-mir-263a |
|||||
Accession | MI0001583 (change log) | ||||
Previous IDs | ame-mir-263 | ||||
Description | Apis mellifera miR-263 stem-loop | ||||
Gene family | MIPF0000122; mir-263 | ||||
Literature search |
6 open access papers mention ame-mir-263a | ||||
Stem-loop |
u u aa u agaa ggauuua 5' agcu ggac cugu auggcac gga uucacggg a |||| |||| |||| ||||||| ||| |||||||| 3' ucgg ccug gaca uacugug ccu aggugccc g - c ca c --cg gggcaaa |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ame-miR-263a-5p |
|
Accession | MIMAT0001479 |
Previous IDs | ame-miR-263 |
Sequence |
13 - guaaauggcacuggaagaauucac - 36 |
Evidence | experimental; array [1], RTPCR [2], Illumina [3] |
References |
|
1 |
PMID:17543122
"Computational and transcriptional evidence for microRNAs in the honey bee genome"
Genome Biol. 8:R97(2007).
|
2 |
PMID:20491979
"Correlated expression patterns of microRNA genes with age-dependent behavioural changes in honeybee"
Insect Mol Biol. 19:431-439(2010).
|
3 |
PMID:22409512
"Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome"
Genes Brain Behav. 11:660-670(2012).
|