Stem-loop sequence mghv-mir-M1-8

Accession

MI0001676 (change log)

Previous IDs

mhv-miR-M1-8

Description

Mouse gammaherpesvirus 68 miR-M1-8 stem-loop

Stem-loop

   uuuaccagc       g      u     gga    a 
5'          acucacu gggguu gguca   gauc a
            ||||||| |||||| |||||   |||| g
3'          ugaguga ucccaa ccagu   cuag u
   --uucuuuu       a      -     ---    a 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (EMBL:U97553.1): U97553: 3806-3876 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mghv-mir-M1-8

• mghv-mir-M1-1: U97553: 196-260 [+]
• mghv-mir-M1-10: U97553: 262-322 [+]
• mghv-mir-M1-2: U97553: 562-627 [+]
• mghv-mir-M1-3: U97553: 638-698 [+]
• mghv-mir-M1-11: U97553: 759-811 [+]
• mghv-mir-M1-4: U97553: 956-1049 [+]
• mghv-mir-M1-5: U97553: 1255-1314 [+]
• mghv-mir-M1-6: U97553: 1319-1381 [+]
• mghv-mir-M1-7: U97553: 1660-1719 [+]
• mghv-mir-M1-12: U97553: 1720-1789 [+]
• mghv-mir-M1-13: U97553: 3749-3808 [+]
• mghv-mir-M1-8: U97553: 3806-3876 [+]
• mghv-mir-M1-14: U97553: 5102-5161 [+]
• mghv-mir-M1-15: U97553: 5461-5514 [+]
• mghv-mir-M1-9: U97553: 5525-5584 [+]

Database links

• miRBase Tracker:MI0001676

Mature sequence mghv-miR-M1-8-5p

• Accession: MIMAT0001572
• Previous IDs: mhv-miR-M1-8;mghv-miR-M1-8
• Sequence: 7 - agcacucacuggggguuugguc - 28
• Evidence: experimental; cloned [1-3], 454 [4], Illumina [5]

Mature sequence mghv-miR-M1-8-3p

• Accession: MIMAT0017191
• Previous IDs: mghv-mir-M1-8*;mghv-miR-M1-8*
• Sequence: 46 - ugaccaacccuaagugaguuuu - 67
• Evidence: experimental; 454 [4]

References

1. PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:19948768 "Mature and functional viral miRNAs transcribed from novel RNA polymerase III promoters" Diebel KW, Smith AL, van Dyk LF RNA. 16:170-185(2010).
4. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5. PMID:20660200 "Identification of novel microRNA-like molecules generated from herpesvirus and host tRNA transcripts" Reese TA, Xia J, Johnson LS, Zhou X, Zhang W, Virgin HW J Virol. 84:10344-10353(2010).