WARNING: This summary was generated by AI. Hsa-mir-451 is a microRNA that has been identified as a significant biomarker in various diseases, including tuberculosis and glioblastoma [PMC3189221]'>PMC3189221], [PMC4673232]. In tuberculosis research, hsa-mir-451, along with other microRNAs, demonstrated increased expression in patients with active tuberculosis compared to those without active disease [PMC3189221]. This differential expression suggests that hsa-mir-451 may serve as a biomarker for detecting active tuberculosis [PMC3189221]. In quantitative PCR assays, hsa-mir-451 has been utilized as an inter-plate calibrator (IPC) in replicates QG1 and QB1 to ensure the consistency and accuracy of results across different plates [PMC7893782]. Additionally, studies have shown that hsa-mir-451 is up-regulated in glioblastoma tissues relative to normal brain tissues, indicating its involvement in cancer pathogenesis and its potential as a diagnostic or prognostic marker [PMC4673232].
c a A A uuggg auggcaagg AACCGUUACCAUUACUG G ||||| ||||||||| ||||||||||||||||| gaccc uaucguucu uugguaaugguaaugau U a a c U
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0001631 |
| Description | Homo sapiens hsa-miR-451a mature miRNA |
| Sequence | 17 - AAACCGUUACCAUUACUGAGUU - 38 |
| Evidence |
experimental
cloned [1-3] |
| Database links |
|
| Predicted targets |
|
|