Stem-loop sequence sof-MIR396

AccessionMI0001755 (change log)
DescriptionSaccharum officinarum miR396 stem-loop
Gene family MIPF0000047; MIR396
Literature search

7 open access papers mention sof-MIR396
(26 sentences)

Stem-loop
   aga      -       ga c            c             -  -aa -   -  c  c    a 
5'    uggccu ucuuugu  u uuccacagcuuu uugaacugcaucu cu   g agg ag ag ucga g
      |||||| |||||||  | |||||||||||| ||||||||||||| ||   | ||| || || ||||  
3'    accgga agagacg  a agggugucgaaa aacuugacgugga ga   c ucc uc uc agcu c
   --a      g       uc a            u             c  gua g   a  -  a    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sof-miR396

Accession MIMAT0001657
Sequence

21 - 

uuccacagcuuucuugaacug

 - 41

Get sequence
Evidence by similarity; MI0001046

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).