Stem-loop sequence sof-MIR159a

AccessionMI0001756 (change log)
DescriptionSaccharum officinarum miR159a stem-loop
Gene family MIPF0000010; MIR159
Literature search

7 open access papers mention sof-MIR159a
(39 sentences)

Stem-loop
   ccu    cu      -u  a           a   u     u  ag    -  ucug     --uu  u c   g    u     guuc    uau         ucauguauguguguauguauuuucgagaggg 
5'    gaug  uggauu  ga gcggagcuccu uca uccaa ga  ggcc gu    aaggg    gu c gcu cucg ucaug    ccac   ccuaucuca                               a
      ||||  ||||||  || ||||||||||| ||| ||||| ||  |||| ||    |||||    || | ||| |||| |||||    ||||   |||||||||                               g
3'    cuac  accuag  cu cgucucgaggg agu agguu cu  ccgg cg    uuccc    ca g cga gagc aguac    ggug   ggauagagu                               g
   --c    cu      uc  a           a   u     u  cg    u  ----     cugc  c u   g    c     guuu    uuc         uucugcuggugguacucucagaucgaggaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sof-miR159a

Accession MIMAT0001658
Sequence

226 - 

uuuggauugaagggagcucug

 - 246

Get sequence
Evidence by similarity; MI0001093

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).