Stem-loop sequence sof-MIR159c

AccessionMI0001760 (change log)
DescriptionSaccharum officinarum miR159c stem-loop
Gene family MIPF0000010; MIR159
Literature search

7 open access papers mention sof-MIR159c
(39 sentences)

Stem-loop
   ugaagacgacgacgaagaagaagauggcgaagaaaagugaucgaa                  uc  g         ----    c    g  g  g    u     g      -cucu       caa   - u 
5'                                              gagcucccuucgauccaa  ca gaggggaag    uggu gguu ca cu ccgg ucaug augccu     ggugcag   uga c a
                                                ||||||||||||||||||  || |||||||||    |||| |||| || || |||| ||||| ||||||     |||||||   ||| |  
3'                                              cucgagggaaguuagguu  gu cucccuuuc    acca ccaa gu ga ggcc aguac uguggg     ucacguc   acu g a
   ------------------------ucucucucuccuuucucucuc                  -c  g         uacu    c    -  a  g    c     g      uacgu       --c   c u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sof-miR159c

Accession MIMAT0001662
Sequence

199 - 

cuuggauugaagggagcuccu

 - 219

Get sequence
Evidence by similarity; MI0001097

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).