Stem-loop sequence sof-MIR167b

AccessionMI0001762 (change log)
DescriptionSaccharum officinarum miR167b stem-loop
Gene family MIPF0000125; MIR167_2
Literature search

7 open access papers mention sof-MIR167b
(31 sentences)

Stem-loop
   agug    -a    a   u           c              gugguauauaugaauauaugaugucuuuaccucugaucucucccugacug 
5'     gugc  ccac agu ggugaagcugc agcaugaucugaug                                                  u
       ||||  |||| ||| ||||||||||| ||||||||||||||                                                   
3'     cacg  ggug ucg cuacuuugaug ucguacuggacuac                                                  c
   --ua    ag    g   u           -              gaguaauagggagaaagaagggaggggaguaggaccuaaguaccuaggca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sof-miR167b

Accession MIMAT0001664
Sequence

21 - 

ugaagcugccagcaugaucug

 - 41

Get sequence
Evidence by similarity; MI0001113

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).