Stem-loop sequence sof-MIR168a

Accession

MI0001763 (change log)

Description

Saccharum officinarum miR168a stem-loop

Gene family

MIPF0000081; MIR168

Literature search

5 open access papers mention sof-MIR168a
(23 sentences)

Stem-loop

   gcc  c      c   g gc             au     c   ccg    g 
5'    gc gcgccg cuc g  ucgcuuggugcag  cggga ccg   cccg c
      || |||||| ||| |  |||||||||||||  ||||| |||   |||| c
3'    cg cgcggc gag c  agugaaccacguu  gcccu ggc   gggc g
   -ac  a      c   g ua             cc     a   --a    a 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Database links

• miRBase Tracker:MI0001763

Mature sequence sof-miR168a

• Accession: MIMAT0001665
• Sequence: 21 - ucgcuuggugcagaucgggac - 41
• Evidence: by similarity; MI0001115

References

1. PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2. "Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).