![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sof-MIR168a |
|
Accession | MI0001763 (change log) |
Description | Saccharum officinarum miR168a stem-loop |
Gene family | MIPF0000081; MIR168 |
Literature search |
![]()
5 open access papers mention sof-MIR168a |
Stem-loop |
gcc c c g gc au c ccg g 5' gc gcgccg cuc g ucgcuuggugcag cggga ccg cccg c || |||||| ||| | ||||||||||||| ||||| ||| |||| c 3' cg cgcggc gag c agugaaccacguu gcccu ggc gggc g -ac a c g ua cc a --a a |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence sof-miR168a |
|
Accession | MIMAT0001665 |
Sequence |
21 - ucgcuuggugcagaucgggac - 41 |
Evidence | by similarity; MI0001115 |
References |
|
1 |
PMID:15916721
"Identification and characterization of new plant microRNAs using EST analysis"
Cell Res. 15:336-360(2005).
|
2 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|