Stem-loop sequence sof-MIR408d

AccessionMI0001768 (change log)
DescriptionSaccharum officinarum miR408d stem-loop
Gene family MIPF0000102; MIR408
Literature search

9 open access papers mention sof-MIR408d
(90 sentences)

Stem-loop
   -ggaa    uguu  auu    a      c       a   u   a     c  u     aaauuuccaauuuccguuugcuugcucacaaaacgaaggugccugccu 
5'      ggua    ug   ggag caggga gaggcag gca ggg ugggg ca caaca                                                c
        ||||    ||   |||| |||||| ||||||| ||| ||| ||||| || |||||                                                c
3'      ccgu    ac   ccuc gucccu cuccguc cgu ccc accuu gu guugu                                                c
   cguuc    ugcc  --c    g      u       a   c   -     c  u     gguccuguggucgacucgagagucgggagaguccaguccgguaguggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sof-miR408d

Accession MIMAT0001670
Sequence

176 - 

cugcacugccucuucccuggc

 - 196

Get sequence
Evidence by similarity; MI0001149

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).