![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR160a |
|||||
Accession | MI0001774 (change log) | ||||
Previous IDs | gma-MIR160 | ||||
Description | Glycine max miR160 stem-loop | ||||
Gene family | MIPF0000032; MIR160 | ||||
Literature search |
![]()
21 open access papers mention gma-MIR160a | ||||
Stem-loop |
c ac ugu c cu ug c c a 5' caug au auaug augugc uggcucc guaugccauu uagag ucau ga g |||| || ||||| |||||| ||||||| |||||||||| ||||| |||| || 3' guac ua uauac uauacg accgagg uaugcgguag guuuc agua cu c a ca -uu a ag gu c a a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR160a-5p |
|
Accession | MIMAT0001676 |
Previous IDs | gma-miR160 |
Sequence |
21 - ugccuggcucccuguaugcca - 41 |
Evidence | experimental; 454 [1] |
Mature sequence gma-miR160a-3p |
|
Accession | MIMAT0022889 |
Sequence |
82 - gcguaugaggagccaagcaua - 102 |
Evidence | experimental; Illumina [3] |
References |
|
1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
2 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
3 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|