![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR156a |
|||||
Accession | MI0001784 (change log) | ||||
Description | Glycine max miR156a stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
41 open access papers mention gma-MIR156a | ||||
Stem-loop |
-cacacc u a a - - au agug u a 5' aga ug g gaggcugacaga agaga gugagcac gcu gua uuguaug g ||| || | |||||||||||| ||||| |||||||| ||| ||| ||||||| 3' ucu ac c cuucgacugucu ucucu cacucgug ugg cgu aacauac g cauuuuu u - - a u cg ---g u g |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR156a |
|
Accession | MIMAT0001686 |
Sequence |
21 - ugacagaagagagugagcac - 40 |
Evidence | experimental; 454 [1,3] |
References |
|
1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
2 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
3 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|