Stem-loop gma-MIR156b

Accession

MI0001790

Description

Glycine max gma-MIR156b precursor miRNA

Gene family

MIPF0000008; MIR156

Literature search

41 open access papers mention gma-MIR156b
(188 sentences)

Sequence

ugaugugagauaucucauguUGACAGAAGAGAGAGAGCACAacccgggaauggcuaaaggagucuuugccuuuguugggagugugcccucucuuccucugucaucaucacauucacaugc
..(((((((.......(((.(((((((.(((((((.(((((.(((((.((.(((.((((....))))))).)).)))))..))))).)))))))..))))))).)))....)))))))..

Structure

ug       auaucuc   u       -A       A     -a     g  u   u    g 
  augugag       aug UGACAGA  GAGAGAG GCACA  cccgg aa ggc aaag a
  |||||||       ||| |||||||  ||||||| |||||  ||||| || ||| ||||  
  uacacuu       uac acugucu  uucucuc cgugu  ggguu uu ccg uuuc g
cg       ---acac   u       cc       c     ga     g  u   -    u 

Annotation confidence Not enough data

Genome context

chr14: 992155-992274 [+]

Mature gma-miR156b

• Accession: MIMAT0001692
• Description: Glycine max gma-miR156b mature miRNA
• Sequence: 21 - UGACAGAAGAGAGAGAGCACA - 41
• Evidence: experimental ; 454 [2], Illumina [3-4]

References

1. Conservation and divergence of microRNA families in plants
   "Dezulian T, Palatnik JF, Huson DH, Weigel D"
   Genome Biol. (2005) 6:P13


2. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506


3. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


4. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153