Stem-loop sequence gma-MIR156b

AccessionMI0001790 (change log)
DescriptionGlycine max miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

41 open access papers mention gma-MIR156b
(186 sentences)

Stem-loop 
   ug       auaucuc   u       -a       a     -a     g  u   u    g 
5'   augugag       aug ugacaga  gagagag gcaca  cccgg aa ggc aaag a
     |||||||       ||| |||||||  ||||||| |||||  ||||| || ||| ||||  
3'   uacacuu       uac acugucu  uucucuc cgugu  ggguu uu ccg uuuc g
   cg       ---acac   u       cc       c     ga     g  u   -    u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 992155-992274 [+]
intergenic
Database links

Mature sequence gma-miR156b

Accession MIMAT0001692
Sequence

21 -  

ugacagaagagagagagcaca

 - 41

Get sequence
Evidence experimental; 454 [2], Illumina [3-4]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
4
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).