![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR156b |
|||||
Accession | MI0001790 (change log) | ||||
Description | Glycine max miR156b stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
41 open access papers mention gma-MIR156b | ||||
Stem-loop |
ug auaucuc u -a a -a g u u g 5' augugag aug ugacaga gagagag gcaca cccgg aa ggc aaag a ||||||| ||| ||||||| ||||||| ||||| ||||| || ||| |||| 3' uacacuu uac acugucu uucucuc cgugu ggguu uu ccg uuuc g cg ---acac u cc c ga g u - u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR156b |
|
Accession | MIMAT0001692 |
Sequence |
21 - ugacagaagagagagagcaca - 41 |
Evidence | experimental; 454 [2], Illumina [3-4] |
References |
|
1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
2 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
3 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|
4 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|