![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptc-MIR164c |
|||||
Accession | MI0002214 (change log) | ||||
Description | Populus trichocarpa miR164c stem-loop | ||||
Gene family | MIPF0000045; MIR164 | ||||
Literature search |
![]()
8 open access papers mention ptc-MIR164c | ||||
Stem-loop |
ua u c ca cucucu 5' gcuc ug uggagaag gggcacgugcaag ccu |||| || |||||||| ||||||||||||| || c 3' uggg ac accucuuc cucgugcacguuc gga -- u a cc -cuuuc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ptc-miR164c |
|
Accession | MIMAT0001920 |
Sequence |
11 - uggagaagcagggcacgugca - 31 |
Evidence | experimental; cloned [1] |
References |
|
1 |
PMID:15994906
"Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis"
Plant Cell. 17:2186-2203(2005).
|
2 |
PMID:16973872
"The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)"
Science. 313:1596-1604(2006).
|