![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptc-MIR166g |
|||||
Accession | MI0002224 (change log) | ||||
Description | Populus trichocarpa miR166g stem-loop | ||||
Gene family | MIPF0000004; MIR166 | ||||
Literature search |
![]()
6 open access papers mention ptc-MIR166g | ||||
Stem-loop |
acac a cu c ---cc - g 5' aguug ggggaaug gucugguucgaga cauuca ugaa gc c ||||| |||||||| ||||||||||||| |||||| |||| || 3' ucaac ccccuuac cggaccaggcucu gugagu acuu cg a -aac c uu a uuucu a c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ptc-miR166g |
|
Accession | MIMAT0001930 |
Sequence |
74 - ucggaccaggcuucauucccc - 94 |
Evidence | by similarity; MI0000206 |
References |
|
1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
2 |
PMID:16973872
"The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)"
Science. 313:1596-1604(2006).
|