Stem-loop sequence ptc-MIR472a

Accession

MI0002354 (change log)

Description

Populus trichocarpa miR472a stem-loop

Literature search

5 open access papers mention ptc-MIR472a
(13 sentences)

Stem-loop

   u   c         -  cg           uuu   u  ug 
5'  uau gggugggug ag  gggaagauaac   ggu uu  a
    ||| ||||||||| ||  |||||||||||   ||| ||   
3'  aua ccuacccac uc  cccuuuuauug   uca ga  g
   g   c         c  au           --u   u  ua 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Poptr2_0; GCA_000002775.2): CM000341.2: 119630-119710 [+]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS00005E6009_3694
• miRBase Tracker:MI0002354

Mature sequence ptc-miR472a

• Accession: MIMAT0002060
• Sequence: 56 - uuuucccuacuccacccauccc - 77
• Evidence: experimental; cloned [1], Northern [1]

References

1. PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).