Stem-loop sequence ptc-MIR478o

AccessionMI0002383 (change log)
DescriptionPopulus trichocarpa miR478o stem-loop
Gene family MIPF0000052; MIR478
Literature search

1 open access papers mention ptc-MIR478o
(1 sentences)

Stem-loop 
   uc     ---uu     auaa       uauucua    --    u    a 
5'   uccuu     uagga    acguuaa       gacg  aguc ccua a
     |||||     |||||    |||||||       ||||  |||| |||| u
3'   aggga     auccu    ugcaauu       cugu  ucag ggau u
   cc     uuuuu     -cug       ---uuua    ag    -    u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 48043128-48043222 [+]
intergenic
Database links

Mature sequence ptc-miR478o

Accession MIMAT0002089
Sequence

70 -  

uaacgugucuccuauuuuuaggga

 - 93

Get sequence
Evidence by similarity; MI0002370

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).