Stem-loop sequence ptc-MIR478s

AccessionMI0002387 (change log)
DescriptionPopulus trichocarpa miR478s stem-loop
Gene family MIPF0000052; MIR478
Literature search

1 open access papers mention ptc-MIR478s
(1 sentences)

Stem-loop 
   --    -auuuu    -   aa       uguuuua   --g    u    a 
5'   ucuc      uagg gau  acguuaa       gac   aguc ccua a
     ||||      |||| |||  |||||||       |||   |||| |||| u
3'   aggg      aucc cug  ugcaauu       cug   ucag ggau u
   cc    auuuuu    u   --       ---uuua   uaa    -    u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 11792555-11792649 [+]
intergenic
Database links

Mature sequence ptc-miR478s

Accession MIMAT0002093
Sequence

70 -  

uaacgugucuccuauuuuuaggga

 - 93

Get sequence
Evidence by similarity; MI0002370

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).