![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptc-MIR482a |
||||||
Accession | MI0002397 (change log) | |||||
Previous IDs | ptc-MIR482 | |||||
Description | Populus trichocarpa miR482a stem-loop | |||||
Gene family | MIPF0000403; MIR482 | |||||
Literature search |
![]()
8 open access papers mention ptc-MIR482a | |||||
Stem-loop |
c c cuu a - u ---- 5' gaguc uag aagu uggag ugggag agua gcaagaaggaa aaauuc ||||| ||| |||| ||||| |||||| |||| ||||||||||| ||||| a 3' cucag guc uucg accuu acccuc ucau cguucuuccuu uuuagu c u ucu - c c auaa |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence ptc-miR482a.2 |
|
Accession | MIMAT0006785 |
Previous IDs | ptc-miR482.2 |
Sequence |
68 - ucuugccuacuccucccauu - 87 |
Evidence | experimental; cloned [2] |
Mature sequence ptc-miR482a.1 |
|
Accession | MIMAT0002103 |
Previous IDs | ptc-miR482;ptc-miR482.1 |
Sequence |
73 - ccuacuccucccauucc - 89 |
Evidence | experimental; cloned [1], PCR [1] |
References |
|
1 |
PMID:15994906
"Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis"
Plant Cell. 17:2186-2203(2005).
|
2 |
PMID:18363789
"Stress-responsive microRNAs in Populus"
Plant J. 55:131-151(2008).
|