Stem-loop sequence mmu-mir-465a

Accession

MI0002400 (change log)

Previous IDs

mmu-mir-465

Description

Mus musculus miR-465a stem-loop

Gene family

MIPF0000384; mir-465

Literature search

7 open access papers mention mmu-mir-465a
(29 sentences)

Stem-loop

   ----   -----          u   a     g    aaaa 
5'     gcc     cuauuuagaa ggc cugau ugau    u
       |||     |||||||||| ||| ||||| ||||     
3'     cgg     gaugaaucuu ccg gacua guua    a
   cauu   aauga          u   g     -    aaaa 

Deep sequencing

279813 reads, 2.28e+03 reads per million, 61 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Yu et al. identified a mature miRNA product from the 5' arm of this precursor, renamed miR-465a-5p here [1]. Watanabe et al. later reported a 3' miRNA product [2].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chrX: 66839052-66839125 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-465a

• mmu-mir-465a: chrX: 66839052-66839125 [-]
• mmu-mir-465b-2: chrX: 66835764-66835842 [-]
• mmu-mir-465c-2: chrX: 66832517-66832597 [-]
• mmu-mir-465b-1: chrX: 66829202-66829280 [-]

Database links

• EntrezGene:Mir465
• RNAcentral:URS000075A93A_10090
• miRBase Tracker:MI0002400

Mature sequence mmu-miR-465a-5p

• Accession: MIMAT0002106
• Previous IDs: mmu-miR-465;mmu-miR-465-5p
• Sequence: 5 - uauuuagaauggcacugauguga - 27
• Deep sequencing: 84644 reads, 50 experiments
• Evidence: experimental; cloned [1,3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00001B9705_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-465a-5p
  • miRDB:mmu-miR-465a-5p
  • microrna.org:mmu-miR-465a-5p

Mature sequence mmu-miR-465a-3p

• Accession: MIMAT0004217
• Previous IDs: mmu-miR-465-3p
• Sequence: 42 - gaucagggccuuucuaaguaga - 63
• Deep sequencing: 195164 reads, 51 experiments
• Evidence: experimental; cloned [2-3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00004AB1CD_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-465a-3p
  • miRDB:mmu-miR-465a-3p
  • microrna.org:mmu-miR-465a-3p

References

1. PMID:15901636 "MicroRNA Mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (Tnp2) messenger RNA (mRNA) by mRNA cleavage" Yu Z, Raabe T, Hecht NB Biol Reprod. 73:427-433(2005).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).