miRBase entry: mmu-mir-465a

Stem-loop mmu-mir-465a


Accession
MI0002400
Description
Mus musculus mmu-mir-465a precursor miRNA mir-465
Gene
family?
RF03464; mir-465

Literature search
7 open access papers mention mmu-mir-465a
(29 sentences)

Sequence

192665 reads, 1750 reads per million, 51 experiments
gcccUAUUUAGAAUGGCACUGAUGUGAuaaaauaaaaaauuGAUCAGGGCCUUUCUAAGUAGAguaaggcuuac
(((((((((((((.(((.(((((...................))))).))).)))))))))).....)))....

Structure
----   -----          U   A     GUGAuaaa 
    gcc     cUAUUUAGAA GGC CUGAU        a
    |||     |||||||||| ||| |||||        u
    cgg     GAUGAAUCUU CCG GACUA        a
cauu   aaugA          U   G     Guuaaaaa 


Annotation confidence Low
Do you think this miRNA is real?
Comments
Yu et al. identified a mature miRNA product from the 5' arm of this precursor, renamed miR-465a-5p here [1]. Watanabe et al. later reported a 3' miRNA product [2].

Genome context
chrX: 66839052-66839125 [-]
Clustered miRNAs
3 other miRNAs are < 10 kb from mmu-mir-465a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-465a-5p

Accession MIMAT0002106
Description Mus musculus mmu-miR-465a-5p mature miRNA
Sequence 5 - UAUUUAGAAUGGCACUGAUGUGA - 27
Evidence experimental
cloned [1,3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-465a-3p

Accession MIMAT0004217
Description Mus musculus mmu-miR-465a-3p mature miRNA
Sequence 42 - GAUCAGGGCCUUUCUAAGUAGA - 63
Evidence experimental
cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 15901636
    MicroRNA Mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (Tnp2) messenger RNA (mRNA) by mRNA cleavage
    "Yu Z, Raabe T, Hecht NB"
    "Biol Reprod (2005) 73:427-433