![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-465a |
||||||||||
Accession | MI0002400 (change log) | |||||||||
Previous IDs | mmu-mir-465 | |||||||||
Description | Mus musculus miR-465a stem-loop | |||||||||
Gene family | MIPF0000384; mir-465 | |||||||||
Literature search |
![]()
7 open access papers mention mmu-mir-465a | |||||||||
Stem-loop |
---- ----- u a g aaaa 5' gcc cuauuuagaa ggc cugau ugau u ||| |||||||||| ||| ||||| |||| 3' cgg gaugaaucuu ccg gacua guua a cauu aauga u g - aaaa |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Comments |
Yu et al. identified a mature miRNA product from the 5' arm of this precursor, renamed miR-465a-5p here [1]. Watanabe et al. later reported a 3' miRNA product [2]. |
|||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence mmu-miR-465a-5p |
|
Accession | MIMAT0002106 |
Previous IDs | mmu-miR-465;mmu-miR-465-5p |
Sequence |
5 - uauuuagaauggcacugauguga - 27 |
Deep sequencing | 84644 reads, 50 experiments |
Evidence | experimental; cloned [1,3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-465a-3p |
|
Accession | MIMAT0004217 |
Previous IDs | mmu-miR-465-3p |
Sequence |
42 - gaucagggccuuucuaaguaga - 63 |
Deep sequencing | 195164 reads, 51 experiments |
Evidence | experimental; cloned [2-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 | |
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|