miRBase entry: mmu-mir-466a

Stem-loop mmu-mir-466a


Accession
MI0002401
Description
Mus musculus mmu-mir-466a precursor miRNA
Gene family
MIPF0000208; mir-466

Literature search
28 open access papers mention mmu-mir-466a
(125 sentences)

Sequence

19070 reads, 321 reads per million, 100 experiments
uauauguguuUAUGUGUGUGUACAUGUACAUAugugaauaugauauccaUAUACAUACACGCACACAUAAGAc
..(((((((...((((((((((.((((((((((....))))).))..))).)))))))))).)))))))....

Structure
--ua       uUA          C   --  -     g 
    uaugugu   UGUGUGUGUA AUG  UA CAUAu u
    |||||||   |||||||||| |||  || |||||  
    AUACACA   GCACAUACAU Uac  au guaua g
cAGA       --C          A   cu  a     a 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr2: 10507918-10507990 [+]
Clustered miRNAs
25 other miRNAs are < 10 kb from mmu-mir-466a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-466a-5p

Accession MIMAT0004759
Description Mus musculus mmu-miR-466a-5p mature miRNA
Sequence 11 - UAUGUGUGUGUACAUGUACAUA - 32
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-466a-3p

Accession MIMAT0002107
Description Mus musculus mmu-miR-466a-3p mature miRNA
Sequence 50 - UAUACAUACACGCACACAUAAGA - 72
Evidence experimental
cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15901636
    MicroRNA Mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (Tnp2) messenger RNA (mRNA) by mRNA cleavage
    "Yu Z, Raabe T, Hecht NB"
    "Biol Reprod (2005) 73:427-433