Accession | MIMAT0002107 |
Description | mmu-miR-466a-3p mature miRNA |
Hairpins | |
Sequence | UAUACAUACACGCACACAUAAGA |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0003091 renal water homeostasis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24389345 | occurs_in CL:1000547 |
acts_upstream_of | GO:0035810 positive regulation of urine volume |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24389345 | occurs_in CL:1000547 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24389345 | has_input UniProtKB:Q9WV30 |
involved_in | GO:0009414 response to water deprivation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24389345 | |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24389345 | has_input UniProtKB:Q9WV30 |