miRBase entry: ssc-mir-21

Stem-loop ssc-mir-21


Accession
MI0002459
Description
Sus scrofa ssc-mir-21 precursor miRNA
Gene family
MIPF0000060; mir-21

Literature search
43 open access papers mention ssc-mir-21
(321 sentences)

Sequence

23974 reads, 6294 reads per million, 15 experiments
uguaccaccuugucgggUAGCUUAUCAGACUGAUGUUGAcuguugaaucucauggCAACAGCAGUCGAUGGGCUGUcugacauuuugguauc
.((((((...((((((((((((((((.(((((.(((((.((((.((...))))))))))).)))))))))))))))))))))...)))))).

Structure
u      ccu                A     A     A    u  a 
 guacca   ugucgggUAGCUUAUC GACUG UGUUG cugu ga  
 ||||||   |||||||||||||||| ||||| ||||| |||| || u
 uauggu   acagucUGUCGGGUAG CUGAC ACAAC ggua cu  
c      uuu                -     G     -    -  c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr12: 37340385-37340476 [+]

Database links

Mature ssc-miR-21-5p

Accession MIMAT0002165
Description Sus scrofa ssc-miR-21-5p mature miRNA
Sequence 18 - UAGCUUAUCAGACUGAUGUUGA - 39
Evidence experimental
cloned [2,5], 454 [3], Illumina [4,6-7]

Mature ssc-miR-21-3p

Accession MIMAT0037322
Description Sus scrofa ssc-miR-21-3p mature miRNA
Sequence 56 - CAACAGCAGUCGAUGGGCUGU - 76
Evidence experimental
Illumina [8]

References

  1. PubMed ID: 15885146
    Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing
    "Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L"
    "BMC Genomics (2005) 6:70

  2. PubMed ID: 19196471
    Cloning, characterization and expression analysis of porcine microRNAs
    Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R
    BMC Genomics (2009) 10:65

  3. PubMed ID: 19917043
    MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
    "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
    "Anim Genet (2010) 41:159-168

  4. PubMed ID: 20180025
    Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
    "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
    "Mol Biol Rep (2010) 37:3567-3574

  5. PubMed ID: 18548309
    Identification and characterization of new microRNAs from pig
    "Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS"
    "Mamm Genome (2008) 19:570-580

  6. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  7. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100

  8. PubMed ID: 25230983
    The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing
    "Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M"
    "J Appl Genet (2015) 56:239-252