miRBase entry: hsa-mir-498

Stem-loop hsa-mir-498


Accession
MI0003142
Symbol
HGNC: MIR498
Description
Homo sapiens hsa-mir-498 precursor miRNA mir-498
Gene
family?
RF00958; mir-498

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR498 is a microRNA gene from the C19MC miRNA cluster, which has been implicated in various cellular processes, including apoptosis and autophagy in cancer cells [PMC5302951]. It has been observed that the overexpression of MIR498 can lead to an increase in early apoptotic fractions in esophageal cancer cells, suggesting its role in promoting apoptosis [PMC5302951]. Additionally, MIR498 is involved in the autophagy pathway, as indicated by its effects on LC3 and p62 protein levels upon transfection into esophageal cancer cell lines [PMC5302951]. Moreover, MIR498 has been linked to the regulation of cell death processes as it can modulate both autophagy and apoptosis [PMC5302951]. In ovarian cancer models, 1,25(OH)2D3 was found to suppress leptin and high-fat diet-induced ovarian cancer through a pathway involving MIR498 [PMC6114234], while its inhibition led to increased proliferation and decreased apoptosis which was reversed by silencing EP300 [PMC8430307]. In breast invasive carcinoma gene expression studies involving C19MC miRNA genes including MIR498 were conducted to understand their cumulative expression patterns [PMC6193703], while synthetic miR-498 mimics were used to demonstrate that transfection could increase intracellular levels of miR-498 [PMC9276052].

Literature search
21 open access papers mention hsa-mir-498
(44 sentences)

Sequence

57 reads, 14 reads per million, 18 experiments
aacccuccuugggaagugaagcucaggcugugaUUUCAAGCCAGGGGGCGUUUUUCuauaacuggaugaAAAGCACCUCCAGAGCUUGAAGCucacaguuugagagcaaucgucuaaggaaguu
.....((((((((........(((((((((((((((((((((.(((((.(((((((...........))))))).))))).).)))))))).))))))))))))........))))))))....

Structure
aaccc        aagugaag            -        - A     C       uaua 
     uccuuggg        cucaggcuguga UUUCAAGC C GGGGG GUUUUUC    a
     ||||||||        |||||||||||| |||||||| | ||||| |||||||    c
     aggaaucu        gaguuugacacu GAAGUUCG G CCUCC CGAAAag    u
-uuga        gcuaacga            C        A A     A       uagg 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr19: 53674197-53674320 [+]
Clustered miRNAs
7 other miRNAs are < 10 kb from hsa-mir-498
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-498 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-498-5p

Accession MIMAT0002824
Description Homo sapiens hsa-miR-498-5p mature miRNA
Sequence 34 - UUUCAAGCCAGGGGGCGUUUUUC - 56
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-498-3p

Accession MIMAT0037323
Description Homo sapiens hsa-miR-498-3p mature miRNA
Sequence 70 - AAAGCACCUCCAGAGCUUGAAGC - 92
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 25822230
    Selective microRNA-Offset RNA expression in human embryonic stem cells
    Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O
    PLoS One (2015) 10:e0116668