miRBase entry: hsa-mir-498

Stem-loop hsa-mir-498


Accession
MI0003142
Symbol
HGNC: MIR498
Description
Homo sapiens hsa-mir-498 precursor miRNA
Gene family
MIPF0000463; mir-498

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR498 is a miRNA gene that has been implicated in various biological processes and diseases [PMC6114234]. It has been reported that 1,25(OH)2D3, a form of vitamin D, can suppress leptin and high-fat diet-induced ovarian cancer through the MIR498 pathway [PMC6114234]. The TCGA miRNA-seq dataset of liver hepatocellular carcinoma (HCC) was used to analyze the expression of all 46 C19MC miRNA genes, including MIR498 [PMC7378193]. MIR498 has been found to have a pol III peak in CD4+ T cells but not HeLa cells [PMC2917008]. Inhibition of MIR498 has been shown to increase proliferation and decrease apoptosis, which can be reversed by silencing the EP300 gene [PMC8430307]. In esophageal cancer cells, transfection of MIR498 along with other miRNAs (MIR20b, MIR30e, and MIR196) affected both the apoptotic pathway and autophagy [PMC5302951]. Similarly, in breast invasive carcinoma cells, cumulative expression analysis revealed the presence of MIR498 along with other C19MC miRNA genes [PMC6193703]. Synthetic mimics of MIR498 have also been used to increase intracellular levels of this miRNA [PMC9276052].

Literature search
21 open access papers mention hsa-mir-498
(44 sentences)

Sequence

58 reads, 70 reads per million, 19 experiments
aacccuccuugggaagugaagcucaggcugugaUUUCAAGCCAGGGGGCGUUUUUCuauaacuggaugaAAAGCACCUCCAGAGCUUGAAGCucacaguuugagagcaaucgucuaaggaaguu
.....((((((((........(((((((((((((((((((((.(((((.(((((((...........))))))).))))).).)))))))).))))))))))))........))))))))....

Structure
aaccc        aagugaag            -        - A     C       uaua 
     uccuuggg        cucaggcuguga UUUCAAGC C GGGGG GUUUUUC    a
     ||||||||        |||||||||||| |||||||| | ||||| |||||||    c
     aggaaucu        gaguuugacacu GAAGUUCG G CCUCC CGAAAag    u
-uuga        gcuaacga            C        A A     A       uagg 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr19: 53674197-53674320 [+]
Clustered miRNAs
7 other miRNAs are < 10 kb from hsa-mir-498
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-498 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-498-5p

Accession MIMAT0002824
Description Homo sapiens hsa-miR-498-5p mature miRNA
Sequence 34 - UUUCAAGCCAGGGGGCGUUUUUC - 56
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-498-3p

Accession MIMAT0037323
Description Homo sapiens hsa-miR-498-3p mature miRNA
Sequence 70 - AAAGCACCUCCAGAGCUUGAAGC - 92
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 25822230
    Selective microRNA-Offset RNA expression in human embryonic stem cells
    Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O
    PLoS One (2015) 10:e0116668