Mature hsa-miR-498-5p
| Accession | MIMAT0002824 |
| Description | hsa-miR-498-5p mature miRNA |
| Hairpins | |
| Sequence | UUUCAAGCCAGGGGGCGUUUUUC |
| Evidence |
experimental
array-cloned [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | |
| acts_upstream_of | GO:0043433 negative regulation of DNA-binding transcription factor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | has_input UniProtKB:O60315 |
| acts_upstream_of | GO:0090090 negative regulation of canonical Wnt signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | has_input UniProtKB:O60315 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | has_input UniProtKB:O60315 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30592286 | has_input UniProtKB:O60315 |
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
