miRBase entry: hsa-mir-517a

Stem-loop hsa-mir-517a


Accession
MI0003161
Symbol
HGNC: MIR517A
Description
Homo sapiens hsa-mir-517a precursor miRNA
Gene family
MIPF0000020; mir-515

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR517A is a placenta-specific miRNA that is only detected in certain types of mesenchymal stem cells (MSCs) [PMC5388876]. It has been shown that certain maternally derived miRNAs, including MIR517A, originate from the placenta, circulate in the mother's plasma, and are cleared shortly after delivery [PMC7468461]. In an individual from Tibet, MIR517A is found to be under copy number variations (CNVs) [PMC3938728]. Studies with BeWo cells have demonstrated that the syncytiotrophoblast (STB) is the main source of released MIR517A [PMC7465902]. In hepatocellular carcinoma (HCC), there are no significant differences in the expression of MIR517A between patients with and without preeclampsia (PE) [PMC4540200]. Furthermore, MIR517A expression has been detected in breast invasive carcinoma samples [PMC6193703]. It has been shown that MIR517A belongs to the C19MC cluster on chromosome 19 and has been associated with stem cell biology and tumorigenesis [PMC8508841]. In patients tested for RNA expression levels, both mir519d and MIR517A showed little to no expression, indicating correct pathological subtyping [PMC9623263].

References:
- PMC5388876
- PMC7468461
- PMC3938728
- PMC7465902
- PMC4540200
- PMC6193703
- PMC8508841
- PMC9623263

Literature search
33 open access papers mention hsa-mir-517a
(190 sentences)

Sequence

224 reads, 19 reads per million, 28 experiments
ucucaggcagugacCCUCUAGAUGGAAGCACUGUCUguuguauaaaagaaaagAUCGUGCAUCCCUUUAGAGUGUuacuguuugaga
((((((((((((((.(((((((.(((.((((.((((...............)))).)))).))).))))))).))))))))))))))

Structure
              C       U   A    U    guugua 
ucucaggcagugac CUCUAGA GGA GCAC GUCU      u
|||||||||||||| ||||||| ||| |||| ||||      a
agaguuugucauUG GAGAUUU CCU CGUG UAga      a
              U       C   A    C    aaagaa 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr19: 53712268-53712354 [+]
Clustered miRNAs
10 other miRNAs are < 10 kb from hsa-mir-517a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-517a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-517-5p

Accession MIMAT0002851
Description Homo sapiens hsa-miR-517-5p mature miRNA
Sequence 15 - CCUCUAGAUGGAAGCACUGUCU - 36
Evidence experimental
array-cloned [1]

Mature hsa-miR-517a-3p

Accession MIMAT0002852
Description Homo sapiens hsa-miR-517a-3p mature miRNA
Sequence 54 - AUCGUGCAUCCCUUUAGAGUGU - 75
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770