miRBase entry: hsa-mir-522

Stem-loop hsa-mir-522


Accession
MI0003177
Symbol
HGNC: MIR522
Description
Homo sapiens hsa-mir-522 precursor miRNA
Gene family
MIPF0000020; mir-515

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-522 is a microRNA that belongs to the hsa-mir-519a cluster [PMC4424562]. It was assayed along with hsa-mir-512 and showed a similar change in gene expression, indicating that this cluster may be regulated as a single unit [PMC4424562]. Seven miRNAs, including hsa-mir-522, were found to have significantly overrepresented targets in MCF7 cells [PMC4401570]. In addition, hsa-mir-522 was predicted to differentially target the FXN gene depending on the allele [PMC3559822]. Variations in the FRDA-3'-UTR created novel target sites for hsa-mir-522 and other miRNAs [PMC3559822]. Hsa-mir-522 has been found to be mentioned in 16 open access papers listed in the miRBase dataset, with many of them focusing on its role in tumor cell proliferation [PMC7366700].

Literature search
16 open access papers mention hsa-mir-522
(141 sentences)

Sequence

137 reads, 16 reads per million, 19 experiments
ucucaggcuguguccCUCUAGAGGGAAGCGCUUUCUGuugucugaaagaaaagAAAAUGGUUCCCUUUAGAGUGUuacgcuuugaga
((((((((.(((.(.((((((((((((.((.(((((....(((...)))..))))).)).)))))))))))).).))))).))))))

Structure
      -  u   u c            G  C     Guug   g 
ucucag gc gug c CUCUAGAGGGAA CG UUUCU    ucu  
|||||| || ||| | |||||||||||| || |||||    ||| a
agaguu cg cau G GAGAUUUCCCUU GU AAAga    aga  
      u  -   U U            G  A     --aa   a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr19: 53751211-53751297 [+]
Clustered miRNAs
8 other miRNAs are < 10 kb from hsa-mir-522
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-522 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-522-5p

Accession MIMAT0005451
Description Homo sapiens hsa-miR-522-5p mature miRNA
Sequence 16 - CUCUAGAGGGAAGCGCUUUCUG - 37
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-522-3p

Accession MIMAT0002868
Description Homo sapiens hsa-miR-522-3p mature miRNA
Sequence 54 - AAAAUGGUUCCCUUUAGAGUGU - 75
Evidence experimental
array-cloned [1], cloned [2-3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770