Stem-loop sequence hsa-mir-505

Accession

MI0003190 (change log)

Symbol

HGNC:MIR505

Description

Homo sapiens miR-505 stem-loop

Gene family

MIPF0000217; mir-505

Literature search

33 open access papers mention hsa-mir-505
(194 sentences)

Stem-loop

        ac    u           g    a        ucug 
5' gaugc  ccag gggggagccag aagu uugauguu    c
   |||||  |||| ||||||||||| |||| ||||||||    c
3' cuacg  gguc cuccuuugguc uuca aacugcga    a
        -a    u           g    c        uuug 

Deep sequencing

36041 reads, 86.2 reads per million, 159 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 139924148-139924231 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR505
• HGNC:MIR505
• RNAcentral:URS000072D134_9606
• miRBase Tracker:MI0003190

Mature sequence hsa-miR-505-5p

• Accession: MIMAT0004776
• Previous IDs: hsa-miR-505*
• Sequence: 15 - gggagccaggaaguauugaugu - 36
• Deep sequencing: 7165 reads, 154 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS000017EA6A_9606
• Predicted targets:
  • TargetMiner:hsa-miR-505-5p
  • TargetScanVert:hsa-miR-505-5p
  • miRDB:hsa-miR-505-5p
  • microrna.org:hsa-miR-505-5p

Mature sequence hsa-miR-505-3p

• Accession: MIMAT0002876
• Previous IDs: hsa-miR-505
• Sequence: 51 - cgucaacacuugcugguuuccu - 72
• Deep sequencing: 28861 reads, 158 experiments
• Evidence: experimental; array-cloned [1], cloned [2-3]
• Database links:
  • RNAcentral:URS00004A5A07_9606
• Predicted targets:
  • TargetMiner:hsa-miR-505-3p
  • TargetScanVert:hsa-miR-505-3p.1
  • miRDB:hsa-miR-505-3p
  • microrna.org:hsa-miR-505-3p

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).