![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR528 |
|||||
Accession | MI0003201 (change log) | ||||
Description | Oryza sativa miR528 stem-loop | ||||
Gene family | MIPF0000868; MIR528 | ||||
Literature search |
![]()
38 open access papers mention osa-MIR528 | ||||
Stem-loop |
u g ca uu -uu c 5' aguggaaggggca gca aggag ggaga cag ugaag u ||||||||||||| ||| ||||| ||||| ||| ||||| g 3' uuaccuucuccgu cgu uccuc ucucu guu acuuc g u g -- cc uuc a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR528-5p |
|
Accession | MIMAT0002884 |
Previous IDs | osa-miR528 |
Sequence |
3 - uggaaggggcaugcagaggag - 23 |
Deep sequencing | 7013 reads, 2 experiments |
Evidence | experimental; Northern [1] |
Database links |
|
Mature sequence osa-miR528-3p |
|
Accession | MIMAT0022926 |
Sequence |
68 - ccugugcuugccucuuccauu - 88 |
Deep sequencing | 2 reads, 1 experiments |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:16126864
"Loss of function of OsDCL1 affects microRNA accumulation and causes developmental defects in rice"
Plant Physiol. 139:296-305(2005).
|
2 |
PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"
PLoS Pathog. 7:e1002176(2011).
|