MIR539 is a microRNA that is part of the miR655 miRNA cluster, which contains a total of 20 miRNAs. Nine of these miRNAs, including MIR539, have available expression data [PMC7465874]. MIR539 has been found to be either upregulated or downregulated in colorectal cancer cases with subsequent relapse, as part of a 5-miRNA signature [PMC5110606]. In non-small cell lung cancer cells, targeting DCLK1 with MIR539 has been shown to increase sensitivity to cisplatin [PMC7904745]. Additionally, MIR539 has been found to be involved in mitochondrial fission and cardiac apoptosis in cardiomyocytes [PMC7123062]. It has also been identified as a sponge for cardiac apoptosis-related lncRNA and regulates PHB2 expression [PMC7123062]. In rat models of myocardial infarction, increased expression of MIR539 inhibits the expression of MEK and leads to impaired proliferation and apoptosis of cardiomyocytes [PMC7527411]. Furthermore, MIR539 is located in the DLK1-DIO3 imprinting region that contains a microRNA cluster involved in leukemia pathogenesis [PMC4633733]. It has also been suggested that MIR539 may contribute to erythropoiesis based on progressive hypomethylation observed during the differentiation process from hematopoietic stem cells to erythroid progenitors [PMC4633733]. Additionally, down-regulation of MIR539 promotes MMP8 expression and activates TGF-β1 signaling in hepatocellular carcinoma progression [PMC8712501].
A G - - uuu auacuugaGGAGAAAUU UCCUUG UGUG Uucg c a ||||||||||||||||| |||||| |||| |||| | u uaugaguuUUUCUUUAA AGGAAC AUAC Aagu g u C - U a uau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003163 |
Description | Homo sapiens hsa-miR-539-5p mature miRNA |
Sequence | 9 - GGAGAAAUUAUCCUUGGUGUGU - 30 |
Evidence |
experimental
cloned [1,3], miRAP-cloned [2] |
Accession | MIMAT0022705 |
Description | Homo sapiens hsa-miR-539-3p mature miRNA |
Sequence | 49 - AUCAUACAAGGACAAUUUCUUU - 70 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|