miRBase entry: hsa-mir-544a

Stem-loop hsa-mir-544a


Accession
MI0003515
Symbol
HGNC: MIR544A
Description
Homo sapiens hsa-mir-544a precursor miRNA

Literature search
15 open access papers mention hsa-mir-544a
(115 sentences)

Sequence

88 reads, 2 reads per million, 39 experiments
auuuucaucaccuagggaucuuguuaaaaagcagauucugauucagggaccaagAUUCUGCAUUUUUAGCAAGUUCucaagugaugcuaau
.....((((((...((((.((((((((((((((((.(((.............))).))))).))))))))))).))))..)))))).....

Structure
auuuu      cua    u           -     u   gauuc 
     caucac   ggga cuuguuaaaaa gcaga ucu     a
     ||||||   |||| ||||||||||| ||||| |||     g
     guagug   cuCU GAACGAUUUUU CGUCU Aga     g
uaauc      -aa    U           A     U   accag 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr14: 101048658-101048748 [+]
Clustered miRNAs
19 other miRNAs are < 10 kb from hsa-mir-544a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-544a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-544a

Accession MIMAT0003164
Description Homo sapiens hsa-miR-544a mature miRNA
Sequence 55 - AUUCUGCAUUUUUAGCAAGUUC - 76
Evidence experimental
cloned [1-2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267