Accession
MI0003530
Symbol
HGNC:
MIR487B
Description
Homo sapiens
hsa-mir-487b precursor miRNA
Gene family
MIPF0000018;
mir-154
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR487B is a microRNA that belongs to the miR655 miRNA cluster and is expressed in various tissues and diseases. It is one of the miRNAs in the cluster that has available expression data [PMC7465874]. MIR487B has been found to be downregulated in gliomas, but its functional role in glial neoplasms has not been explored [PMC5288128]. In an in vivo model of chronic heart failure, MIR487B was found to inhibit the IL-33/ST2 signaling axis, resulting in improved cardiac morphology and reduced collagen expression [PMC8663982]. MIR487B is also part of the DLK1-MEG3 cluster and has been shown to be significantly reduced or silenced by DNA hypermethylation in bladder tumor tissues and cell lines [PMC4348104]. In multiple sclerosis, MIR487B is less expressed in the diseased context [PMC4655260]. Tobacco smoking-induced epigenetic downregulation of MIR487B leads to overexpression of various polycomb group proteins and stem cell-related genes [PMC6116004]. Chromosome 8 contains an expression quantitative trait locus (eQTL) for MIR487B [PMC4755013]. Additionally, elevated levels of MIR487B have been observed in peripheral blood mononuclear cells of patients with stroke [PMC7123062]. Higher expression levels of MIR487B have also been associated with poor survival outcomes based on data from The Cancer Genome Atlas (TCGA) database [PMC5975595]. A-to-I editing and Nm modifications can alter the targets of tumor suppressor microRNA such as MIR487B, promoting angiogenesis. Increased levels of Ψ writers RPUSD3 and RPUSD4 can induce defective assembly of oxidative phosphorylation system proteins [PMC9916637].
Literature search
31 open access papers mention hsa-mir-487b
(50 sentences)
(50 sentences)
Sequence
5540
reads,
85
reads per million, 85 experiments
uugguacuuggagaGUGGUUAUCCCUGUCCUGUUCGuuuugcucaugucgAAUCGUACAGGGUCAUCCACUUuuucaguaucaa
.(((((((.(((((((((....((((((.(.(((((............))))).).))))))....))))))))).))))))).
.(((((((.(((((((((....((((((.(.(((((............))))).).))))))....))))))))).))))))).
Structure
u u UUAU C U uuuug ugguacu ggagaGUGG CCCUGU C GUUCG c ||||||| ||||||||| |||||| | ||||| acuauga uuuUUCACC GGGACA G UAAgc u a c UACU U C uguac
Annotation confidence
Not enough data
Do you think this miRNA is real?
Genome context
chr14: 101046455-101046538 [+]
Clustered miRNAs
19 other miRNAs are < 10 kb from hsa-mir-487b
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-mir-487b is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-487b-3p
| Accession | MIMAT0003180 |
| Description | Homo sapiens hsa-miR-487b-3p mature miRNA |
| Sequence | 51 - AAUCGUACAGGGUCAUCCACUU - 72 |
| Evidence |
experimental
cloned [1-2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-487b-5p
| Accession | MIMAT0026614 |
| Description | Homo sapiens hsa-miR-487b-5p mature miRNA |
| Sequence | 15 - GUGGUUAUCCCUGUCCUGUUCG - 36 |
| Evidence |
experimental
Illumina [3] |
References
|
