miRBase entry: hsa-mir-487b

Stem-loop hsa-mir-487b


Accession
MI0003530
Symbol
HGNC: MIR487B
Description
Homo sapiens hsa-mir-487b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR487B is a microRNA that is part of the miR655 miRNA cluster, which includes a total of 20 miRNAs, with expression data available for nine of these, including MIR487B [PMC7465874]. This microRNA has been identified with 16 mutations, including a hotspot mutation in the seed sequence that is particularly associated with melanoma [PMC9708458]. MIR487B expression has been found to be downregulated in gliomas, although its specific role in these tumors remains to be fully elucidated [PMC5288128]. Functionally, MIR487B has been shown to inhibit the IL-33/ST2 signaling axis and improve cardiac morphology in a model of chronic heart failure [PMC8663982]. Additionally, it is part of the DLK1-MEG3 cluster on chromosome 14q32 and has been found to be downregulated due to DNA hypermethylation in bladder tumors [PMC4348104]. Its expression also appears to be reduced in multiple sclerosis (MS) and can be epigenetically downregulated by tobacco smoking, leading to overexpression of genes involved in stem cell modulation [PMC4655260; PMC6116004].. Furthermore, MIR487B expression levels have been associated with patient survival outcomes and are implicated in angiogenesis through A-to-I editing and Nm modifications that can alter its target specificity [PMC5975595; PMC9916637].. Elevated levels have also been observed in peripheral blood mononuclear cells from stroke patients [PMC7123062].

Literature search
31 open access papers mention hsa-mir-487b
(50 sentences)

Sequence

5540 reads, 22 reads per million, 85 experiments
uugguacuuggagaGUGGUUAUCCCUGUCCUGUUCGuuuugcucaugucgAAUCGUACAGGGUCAUCCACUUuuucaguaucaa
.(((((((.(((((((((....((((((.(.(((((............))))).).))))))....))))))))).))))))).

Structure
u       u         UUAU      C U     uuuug 
 ugguacu ggagaGUGG    CCCUGU C GUUCG     c
 ||||||| |||||||||    |||||| | |||||      
 acuauga uuuUUCACC    GGGACA G UAAgc     u
a       c         UACU      U C     uguac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr14: 101046455-101046538 [+]
Clustered miRNAs
19 other miRNAs are < 10 kb from hsa-mir-487b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-487b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-487b-3p

Accession MIMAT0003180
Description Homo sapiens hsa-miR-487b-3p mature miRNA
Sequence 51 - AAUCGUACAGGGUCAUCCACUU - 72
Evidence experimental
cloned [1-2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-487b-5p

Accession MIMAT0026614
Description Homo sapiens hsa-miR-487b-5p mature miRNA
Sequence 15 - GUGGUUAUCCCUGUCCUGUUCG - 36
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45