miRBase entry: mmu-mir-376c

Stem-loop mmu-mir-376c


Accession
MI0003533
Symbol
MGI: Mir376c
Description
Mus musculus mmu-mir-376c precursor miRNA
Gene family
MIPF0000091; mir-368

Literature search
24 open access papers mention mmu-mir-376c
(42 sentences)

Sequence

13249 reads, 361 reads per million, 72 experiments
uuugguauuuaaaagGUGGAUAUUCCUUCUAUGUUUAugcuuuuugugauuaAACAUAGAGGAAAUUUCACGUuuucagugucaaa
.((((((((.((((.(((((..(((((.(((((((((..(.......)..))))))))))))))..))))).)))).)))))))).

Structure
u        u    g     UA     U         ug uu 
 uugguauu aaaa GUGGA  UUCCU CUAUGUUUA  c  u
 |||||||| |||| |||||  ||||| |||||||||  |  u
 aacuguga uuuU CACUU  AAGGA GAUACAAau  g  u
a        c    G     UA     -         ua ug 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature miR-376c products have been shown to be modified by A to I edits [2].

Genome context
chr12: 109722718-109722803 [+]
Clustered miRNAs
17 other miRNAs are < 10 kb from mmu-mir-376c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-376c-5p

Accession MIMAT0005295
Description Mus musculus mmu-miR-376c-5p mature miRNA
Sequence 16 - GUGGAUAUUCCUUCUAUGUUUA - 37
Evidence experimental
cloned [1], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-376c-3p

Accession MIMAT0003183
Description Mus musculus mmu-miR-376c-3p mature miRNA
Sequence 53 - AACAUAGAGGAAAUUUCACGU - 73
Evidence experimental
cloned [1], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  5. PubMed ID: 17322061
    Redirection of silencing targets by adenosine-to-inosine editing of miRNAs
    "Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K"
    "Science (2007) 315:1137-1140