![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-487b |
||||||||||||||||||||||||||||||||||
Accession | MI0003534 (change log) | |||||||||||||||||||||||||||||||||
Symbol | MGI:Mir487b | |||||||||||||||||||||||||||||||||
Description | Mus musculus miR-487b stem-loop | |||||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||||
Literature search |
![]()
17 open access papers mention mmu-mir-487b | |||||||||||||||||||||||||||||||||
Stem-loop |
u ug uuau c uc - uuc 5' gguacu gagagugg cccugu c uucg c a |||||| |||||||| |||||| | |||| | c 3' cuauga uuuucacc gggaca g aagc g u a cu uacu u cu c uac |
|||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
|||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-487b-5p |
|
Accession | MIMAT0017216 |
Previous IDs | mmu-miR-487b* |
Sequence |
15 - ugguuaucccuguccucuucg - 35 |
Deep sequencing | 75 reads, 25 experiments |
Evidence | experimental; Illumina [4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-487b-3p |
|
Accession | MIMAT0003184 |
Previous IDs | mmu-miR-487b |
Sequence |
50 - aaucguacagggucauccacuu - 71 |
Deep sequencing | 22417 reads, 73 experiments |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|