![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-485 |
||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0003549 (change log) | |||||||||||||||||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-485 stem-loop | |||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000201; mir-485 | |||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
8 open access papers mention rno-mir-485 | |||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
u cu - a auuc 5' gauacu ggagagagg ggccgug auga uucg a |||||| ||||||||| ||||||| |||| |||| u 3' cuguga cuucucucc ucggcac uacu gagc c u uc a - aaau |
|||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-485-5p |
|
Accession | MIMAT0003203 |
Previous IDs | rno-miR-485 |
Sequence |
12 - agaggcuggccgugaugaauuc - 33 |
Deep sequencing | 46510 reads, 337 experiments |
Evidence | experimental; cloned [2], SOLiD [3] |
Predicted targets |
|
Mature sequence rno-miR-485-3p |
|
Accession | MIMAT0017222 |
Previous IDs | rno-miR-485* |
Sequence |
51 - cauacacggcucuccucucuuc - 72 |
Deep sequencing | 17905 reads, 342 experiments |
Evidence | experimental; SOLiD [3] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|