![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-574 |
|||||
Accession | MI0003581 (change log) | ||||
Symbol | HGNC:MIR574 | ||||
Description | Homo sapiens miR-574 stem-loop | ||||
Gene family | MIPF0000419; mir-574 | ||||
Literature search |
![]()
96 open access papers mention hsa-mir-574 | ||||
Stem-loop |
gggaccug g c a u ug gc 5' c ugggug gggcgugug g gugugugugugagugug uc u | |||||| ||||||||| | ||||||||||||||||| || 3' g acucac cccgcacac c cacacacguacucgcac gg c -------- g a - - cu gc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-574-5p |
|
Accession | MIMAT0004795 |
Sequence |
25 - ugagugugugugugugagugugu - 47 |
Deep sequencing | 30638 reads, 165 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-574-3p |
|
Accession | MIMAT0003239 |
Previous IDs | hsa-miR-574 |
Sequence |
61 - cacgcucaugcacacacccaca - 82 |
Deep sequencing | 125985 reads, 160 experiments |
Evidence | experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16505370
"The colorectal microRNAome"
Proc Natl Acad Sci U S A. 103:3687-3692(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|