Stem-loop sequence hsa-mir-574

AccessionMI0003581 (change log)
Symbol HGNC:MIR574
DescriptionHomo sapiens miR-574 stem-loop
Gene family MIPF0000419; mir-574
Literature search

96 open access papers mention hsa-mir-574
(437 sentences)

Stem-loop
   gggaccug g      c         a u                 ug  gc 
5'         c ugggug gggcgugug g gugugugugugagugug  uc  u
           | |||||| ||||||||| | |||||||||||||||||  ||   
3'         g acucac cccgcacac c cacacacguacucgcac  gg  c
   -------- g      a         - -                 cu  gc 
Get sequence
Deep sequencing
156655 reads, 781 reads per million, 166 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 38868032-38868127 [+]
intergenic
Database links

Mature sequence hsa-miR-574-5p

Accession MIMAT0004795
Sequence

25 - 

ugagugugugugugugagugugu

 - 47

Get sequence
Deep sequencing30638 reads, 165 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-574-3p

Accession MIMAT0003239
Previous IDshsa-miR-574
Sequence

61 - 

cacgcucaugcacacacccaca

 - 82

Get sequence
Deep sequencing125985 reads, 160 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).