miRBase entry: hsa-mir-642a

Stem-loop hsa-mir-642a


Accession
MI0003657
Symbol
HGNC: MIR642A
Description
Homo sapiens hsa-mir-642a precursor miRNA
Gene family
MIPF0000468; mir-642

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR642A is a microRNA that has been found to be downregulated in multiple myeloma (MM) patients [PMC5395780]. It has been shown to modulate the expression of DEPTOR, a protein involved in the regulation of cell size and endoplasmic reticulum (ER) mass [PMC5395780]. The downregulation of DEPTOR by transfection of MM cells with miR135b or MIR642A resulted in the downregulation of IRF4 and k light chain proteins, indicating a role for MIR642A in modulating the transcriptional program of myeloma cells [PMC5395780]. Luciferase reporter assays and gain-of-function experiments confirmed that transfection of miR135b and MIR642A decreased DEPTOR levels in myeloma cells [PMC5395780'>PMC5395780'>PMC5395780]. Furthermore, knockdown of MIR642A and miR135b resulted in increased DEPTOR expression, providing further evidence for their role in controlling DEPTOR levels [PMC5395780]. The 3'UTR of DEPTOR contains binding sites for both MIR642A and miR135b, as confirmed by luciferase reporter assays [PMC5395780]. These findings suggest that the downregulation of MIR642A and miR135b may contribute to the overexpression of DEPTOR observed in MM patients [PMC5395780].

Literature search
9 open access papers mention hsa-mir-642a
(64 sentences)

Sequence

1444 reads, 75 reads per million, 92 experiments
aucugaguugggaggGUCCCUCUCCAAAUGUGUCUUGgggugggggaucaAGACACAUUUGGAGAGGGAACCucccaacucggccucugccaucauu
....(((((((((((.((((((((((((((((((((((.........)))))))))))))))))))))).)))))))))))(((....)))......

Structure
------------aucu           G                      ggu 
                gaguugggagg UCCCUCUCCAAAUGUGUCUUGg   g
                ||||||||||| ||||||||||||||||||||||   g
                cucaacccuCC AGGGAGAGGUUUACACAGAacu   g
uuacuaccgucuccgg           A                      agg 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr19: 45674928-45675024 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-642a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-642a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-642a-5p

Accession MIMAT0003312
Description Homo sapiens hsa-miR-642a-5p mature miRNA
Sequence 16 - GUCCCUCUCCAAAUGUGUCUUG - 37
Evidence experimental
RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-642a-3p

Accession MIMAT0020924
Description Homo sapiens hsa-miR-642a-3p mature miRNA
Sequence 51 - AGACACAUUUGGAGAGGGAACC - 72
Evidence experimental
SOLiD [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  3. PubMed ID: 21767385
    Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis
    Zaragosi LE, Wdziekonski B, Brigand KL, Villageois P, Mari B, Waldmann R, Dani C, Barbry P
    Genome Biol (2011) 12:R64