Stem-loop hsa-mir-1296

Accession

MI0003780

Symbol

HGNC: MIR1296

Description

Homo sapiens hsa-mir-1296 precursor miRNA

Gene family

MIPF0000649; mir-1296

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR1296 is a microRNA that is involved in the serotonin-mediated signaling pathway regulating myogenic differentiation [PMC8396502]. In a study using NanoString technology, it was found that MIR1296, along with other miRNAs such as miR3185, miR28, miR182, and miR614, showed significant changes in their levels with pre-shift/post-shift or change with PoMS subscales TMD or FI [PMC9105576]. In the context of Alzheimer's disease (AD), MIR1296 was found to be downregulated in the cortex of AD patients [PMC7564652]. Additionally, MIR129-2 and MIR219A1 were also downregulated in AD patients' cortex [PMC7564652]. On the other hand, MIR199A2 and MIR92A1 were upregulated in AD patients' cortex [PMC7564652]. The dysregulation of MIR129-2, MIR219A1, and other miRNAs such as MIR29B1 and MIR199A2 has been previously reported in AD patients and was confirmed by this study [PMC7564652]. However, for some miRNAs like MIR129-2, MIR1296, and MIR99A that were found to be dysregulated in AD patients' cortex by this study as well as previous studies. The specific pathways or targets associated with these dysregulations have not been identified yet [PMC7564652].

Literature search

13 open access papers mention hsa-mir-1296
(259 sentences)

Sequence

9293 reads, 123 reads per million, 124 experiments

accuaccuaacugggUUAGGGCCCUGGCUCCAUCUCCuuuaggaaaaccuucugugggGAGUGGGGCUUCGACCCUAACCcaggugggcugu
.(((((((....(((((((((....(((((((.((((((..((((....))))..)))))))))))))....))))))))))))))))....

Structure

---a       aacu         CCCU       U      ua    a 
    ccuaccu    gggUUAGGG    GGCUCCA CUCCuu  ggaa a
    |||||||    |||||||||    ||||||| ||||||  ||||  
    gggugga    cCCAAUCCC    UCGGGGU GAGggg  ucuu c
uguc       ----         AGCU       -      ug    c 

Annotation confidence High

Genome context

chr10: 63372957-63373048 [-]

Disease association

hsa-mir-1296 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-1296-5p

• Accession: MIMAT0005794
• Description: Homo sapiens hsa-miR-1296-5p mature miRNA
• Sequence: 16 - UUAGGGCCCUGGCUCCAUCUCC - 37
• Evidence: experimental ; Illumina [2,4], 454 [3]

Mature hsa-miR-1296-3p

• Accession: MIMAT0026637
• Description: Homo sapiens hsa-miR-1296-3p mature miRNA
• Sequence: 59 - GAGUGGGGCUUCGACCCUAACC - 80
• Evidence: experimental ; Illumina [4]

References

1. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298


2. PubMed ID: 18285502
   Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
   "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
   "Genome Res (2008) 18:610-621


3. PubMed ID: 19508715
   Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing
   Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Møller S, Krogh A, Litman T
   BMC Med Genomics (2009) 2:35


4. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45