miRBase entry: mmu-mir-216b

Stem-loop mmu-mir-216b


Accession
MI0004126
Symbol
MGI: Mir216b
Description
Mus musculus mmu-mir-216b precursor miRNA
Gene family
MIPF0000054; mir-216

Literature search
24 open access papers mention mmu-mir-216b
(81 sentences)

Sequence

11404 reads, 201 reads per million, 40 experiments
uuggcagacugggAAAUCUCUGCAGGCAAAUGUGAugucacugaagaaaccacACACUUACCUGUAGAGAUUCUUcagucugacaa
.((.(((((((((.((((((((((((.((.((((.((((......))...)))))).)).)))))))))))).))))))))).)).

Structure
u  g         A            C  A    A  ---  ac 
 ug cagacuggg AAUCUCUGCAGG AA UGUG ug   uc  u
 || ||||||||| |||||||||||| || |||| ||   ||   
 ac gucugacUU UUAGAGAUGUCC UU ACAc ac   ag  g
a  a         C            A  C    -  caa  aa 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr11: 28746191-28746276 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-216b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-216b-5p

Accession MIMAT0003729
Description Mus musculus mmu-miR-216b-5p mature miRNA
Sequence 14 - AAAUCUCUGCAGGCAAAUGUGA - 35
Evidence experimental
MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-216b-3p

Accession MIMAT0017233
Description Mus musculus mmu-miR-216b-3p mature miRNA
Sequence 54 - ACACUUACCUGUAGAGAUUCUU - 75
Evidence experimental
Illumina [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771