miRBase entry: mmu-mir-671

Stem-loop mmu-mir-671


Accession
MI0004133
Symbol
MGI: Mir671
Description
Mus musculus mmu-mir-671 precursor miRNA
Gene family
MIPF0000358; mir-671

Literature search
20 open access papers mention mmu-mir-671
(64 sentences)

Sequence

20999 reads, 182 reads per million, 104 experiments
uggcaggccaggaagaggAGGAAGCCCUGGAGGGGCUGGAGgugauggauguuuuccUCCGGUUCUCAGGGCUCCACCucuuucgagccguagagcca
((((.(((..((((((((.(((.((((((..(((((((((((.((.......)).)))))))))))))))))))).))))))))..))).....))))

Structure
    ----a   ca        A   A      GA           u  ug 
uggc     ggc  ggaagagg GGA GCCCUG  GGGGCUGGAGg ga  g
||||     |||  |||||||| ||| ||||||  ||||||||||| ||  a
accg     ccg  cuuucuCC CCU CGGGAC  UCUUGGCCUcc uu  u
    agaug   ag        A   -      --           u  ug 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr5: 24592114-24592211 [+]

Database links

Mature mmu-miR-671-5p

Accession MIMAT0003731
Description Mus musculus mmu-miR-671-5p mature miRNA
Sequence 19 - AGGAAGCCCUGGAGGGGCUGGAG - 41
Evidence experimental
MPSS [1], RAKE [2], cloned [3], Illumina [4]
Database links
Predicted targets

Mature mmu-miR-671-3p

Accession MIMAT0004821
Description Mus musculus mmu-miR-671-3p mature miRNA
Sequence 58 - UCCGGUUCUCAGGGCUCCACC - 78
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  5. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298